Biologia das Comunicações, volume 6, número do artigo: 646 (2023) Citar este artigo
896 acessos
22 Altmétrico
Detalhes das métricas
O controlo químico dos mosquitos vectores de doenças Aedes albopictus e Aedes aegypti é dispendioso, insustentável e cada vez mais ineficaz devido à propagação da resistência aos insecticidas. A técnica do inseto estéril é uma alternativa valiosa, mas é limitada por métodos de separação de sexo lentos, propensos a erros e desperdiçadores. Aqui, apresentamos quatro cepas de sexagem genética (duas para cada espécie de Aedes) baseadas em marcadores de fluorescência ligados aos loci sexuais m e M, permitindo o isolamento de machos transgênicos. Além disso, demonstramos como a combinação dessas cepas de sexagem permite a produção de machos não transgênicos. Em uma instalação de criação em massa, 100.000 larvas masculinas de primeiro ínstar poderiam ser classificadas em menos de 1,5 h, com uma contaminação feminina estimada de 0,01 a 0,1% em uma única máquina. As análises de custo-eficiência revelaram que a utilização destas estirpes poderia resultar em poupanças importantes durante a criação e funcionamento de uma instalação de criação em massa. No seu conjunto, estas estirpes de sexagem genética deverão permitir um grande aumento nos programas de controlo contra estes importantes vectores.
Aedes aegypti e Aedes albopictus são espécies invasoras de mosquitos responsáveis pela transmissão de muitos patógenos, incluindo os vírus dengue (DENV), chikungunya (CHIKV), zika (ZIKV) e febre amarela (YFV)1,2. Impulsionados pelas alterações climáticas e pelo comércio mundial, ambos os vectores estão a espalhar-se rapidamente e prevê-se que 49% da população mundial estará em risco de contrair doenças transmitidas pelo Aedes até 2050, na ausência de medidas de controlo eficazes3,4.
A supressão das populações de mosquitos através do controlo genético é uma das alternativas mais eficazes, sustentáveis e amigas do ambiente ao uso de insecticidas. Baseia-se em repetidas liberações em massa de mosquitos machos que não picam – sejam estéreis (a Técnica do Inseto Estéril, SIT5, e seus derivados, incluindo o pgSIT6), infectados com Wolbachia (a Técnica do Inseto Incompatível, IIT7,8,9), ambos10,11, ou carregando um transgene letal (Liberação de Insetos carregando um Letal Dominante, RIDL)12. Para todas estas intervenções, é necessário um método eficiente de separação de sexos. Atualmente, os mosquitos Aedes são sexados com base no dimorfismo natural do tamanho da pupa usando um classificador de Hoch, que pode ser totalmente manual13,14 ou parcialmente automatizado11. Este método, que requer tamanho de pupa homogêneo e, portanto, condições de criação de larvas com densidade otimizada, sofre com taxas de contaminação feminina entre 0,8 e 1% e alta variabilidade diária e de usuário para usuário . Notavelmente, um classificador de pupas e adultos em várias etapas foi recentemente descrito, o que permitiu 1,13 × 10-7% de contaminação feminina9. No entanto, este sistema, como todos os outros métodos existentes, partilha a desvantagem de separar numa fase tardia e recuperar menos de metade dos machos criados, o que significa que> 75% do total de pupas são criadas e alimentadas em vão.
Em mosquitos Anopheles, foram descritas cepas transgênicas de sexagem genética (GSSs) que permitem a separação sexual automatizada de larvas jovens . Os marcadores fluorescentes exibem expressão específica do homem, seja pelo uso de sequências regulatórias específicas do homem ou pela ligação dos marcadores ao cromossomo Y. Uma cepa de sexagem de Anopheles coluzzii está ligada ao cromossomo X20, tornando as fêmeas mais fluorescentes que os machos. A separação dos sexos é realizada usando um dispositivo Complex Object Parametric Analyzer and Sorter (COPAS), que funciona como um citômetro de fluxo, classificando partículas grandes de acordo com sua fluorescência. Além disso, como alternativa à liberação de machos transgênicos, foi proposto um esquema de cruzamento gerando populações somente de machos não transgênicos utilizando o COPAS21. Este esquema requer uma cepa que carregue um marcador de fluorescência no cromossomo Y e outra que carregue um marcador de fluorescência no cromossomo X. O cruzamento de fêmeas não transgênicas (X−/X−) da primeira linhagem com machos transgênicos (X+/Y−) da segunda resulta em uma progênie composta por fêmeas transgênicas (X+/X−) e não transgênicas (X−/Y). −) homens.
120 piggyBac random insertions (Fig. 1d). The best m-linked insertion line that we obtained showed a recombination frequency of 0.1%. Its transgenic cassette harboured a Cas9 transgene associated with a DsRed fluorescence marker and was flanked by lox sites. A Cas9 transgene being undesirable in a sexing strain, we excised it using CRE recombinase and replaced it with an eGFP transgene. This Ae. albopictus m-linked strain was termed Aal-m. Sequencing of the transposon’s flanking genomic sequence indicated that it had landed into a highly repeated region; hence, its exact genomic location could not be identified but matched several loci in 1q31 (see Methods and Supplementary Data 1). Both Ae. albopictus transgenic lines show a clear sex-separation pattern in COPAS analyses (Fig. 1c, d). All four lines were fluorescence-sorted and screened at each generation. In the Aaeg-M line, a single recombination event was visually recorded after 15 generations (>10,000 individuals screened in total). Consequently, we estimated that the Aaeg-M and Aaeg-m lines recombine at approximately 0.01%. In Aal-M, four recombinant individuals were observed in the tenth generation after successively screening a total of >50,000 individuals. These recombinations are likely to have arisen from a single event, suggesting that recombination is extremely rare in the Aal-M strain as well./p>$50,000 savings at 20 M males/week and above, Fig. 5e). In total, considering construction, equipment, diet and consumable costs, GSS is predicted to be the most economical option at all tested throughputs, while GSS-CS starts to be more economical compared to manual sorting of pupae from a 10 M males/week throughput (Fig. 5f). Moreover, the workload, the cost of which can only be estimated on a country-by-country basis, is reduced by 29–38% with GSS and 18–27% with GSS-CS (Fig. 5g). For all comparisons, including equipment cost, the most expensive option is the automated sorting of pupae, as the devices are expensive (e.g. $40k for the automated sorter from11, J. Bouyer) and the number of insects to be reared is high (Fig. 5b–g)./p>20,000 screened larvae), we later injected the repair donor plasmid (190 ng/µL) with 5 µM Scr7 and three plasmids expressing different gRNAs under the control of different AeU6 promoters (70 ng/µL each plasmid). This method gave significantly higher knock-in rates (25 GFP positive larvae out of about 4000 screened)./p>20,000 G1 larvae screened, a single transgenic male larva was found, raised to adulthood, and crossed to WT females. Its progeny was composed of 100% eGFP positive sons and 100% eGFP negative daughters, indicative of M linkage. We termed this Ae. aegypti M-linked strain Aaeg-M. Upon injection of 600 BgR9 eggs with the pX3 repair plasmid and a mixture of three plasmids expressing gRNAs (GTGGCATAGCGCCGTGTGGA[GGG], GTCTTAAATGAAAGAGGCG[AGG], GTATCATGCGTATTGCGAG[AGG], brackets indicate the PAM) under the control of three different U6 promoters (gRNA cloning vectors: Supplementary Data 4), 43 larvae with transient eGFP expression were recovered in G0. Resulting 20 males and 20 females were crossed en masse to adults of the opposite sex. 25 transgenic G1 larvae were obtained, 10 of which were males carrying an M-linked insertion, 4 were males carrying an m-linked insertion and 11 were females carrying an m-linked insertion. Proper insertion site in AAEL019619 was confirmed by PCR in all tested individuals, which revealed that in some of these mosquitoes the whole repair plasmid had integrated. From a single male devoid of the plasmid backbone, an Ae. aegypti m-linked strain named Aaeg-m was established and further characterized. Both Aaeg-M and Aaeg-m lines were backcrossed into a Brazilian (Bra) genetic background for 7 generations./p>700 individuals screened in each line until the sixth generation (Supplementary Table 3). Most other M-linked lines also showed 100% fluorescent males but contained additional, non-M-linked multiple insertions and were discarded. Based on line fitness and COPAS profiles, we selected a YFP line termed Aal-M for further work as an Ae. albopictus M-linked strain. Additional M-linked lines marked with OpIE2-GFP or Pub-DsRed showing no recombination to date, carrying a docking attP site for subsequent transgenesis, and representing additional GSSs are also being maintained to date but were not further characterized in detail./p>120 random piggyBac insertions. For this, we screened our existing collection of Ae. albopictus transgenic lines for m/M-linkage and constructed an additional library of piggyBac constructs expressing various fluorescence proteins (eGFP, mTurquoise2, YFP or DsRed) under the control of promoters showing distinct expression patterns (3xP3, OpIE2, Ae. aegypti PUb, Drosophila melanogaster actin5C). By performing multiplex injections of these piggyBac plasmids together, we obtained lines carrying up to six distinct insertions as indicated by their colours and patterns of fluorescence. Out of 40 independent founder transgenic individuals screened (most of which carrying multiple insertions), only two insertions appeared m-linked: one carried an OpIE2-mTurquoise2 marker gene with a recombination rate of about 3%, and the other, called m-albR9, carried a Cas9 transgene with a DsRed reporter gene and showed a recombination rate of 0.1%. We exploited the latter, in which transgenes are flanked by two lox sites adjacent to an attP docking site. We injected m-albR9 eggs with a plasmid encoding Cre recombinase to excise Cas9 and DsRed transgenes, as Cas9 is undesirable in a GSS. From successfully excised individuals, we established an m-linked attP docking line, mX1, carrying no further transgene. In a second step, an attB-containing plasmid carrying a PUb-eGFP marker cassette was integrated into the attP site. The m-linkage of this new strain was verified by crossing eGFP males to WT females and screening their offspring. The new Ae. albopictus m-linked line, named Aal-m was made hemi/homozygous and amplified./p>
Português
English
Français
Deutsch
Español
Italiano
日本語
한국어
Русский